Marihuana y cerveza, juntos en fiestas y en su ADN!

Por Daniela Vergara (@CannaGenomics) and Reilly Capps (@ReillyCapps)

Traducido al español por Daniela Vergara

En el Cannabis Genomics Research Initiative (CGRI) orgullosamente hemos publicado el primer artículo científico sobre Cannabis procedente del laboratorio del profesor Nolan Kane. Los investigadores de CGRI somos detectives genéticos que exploramos los misterios de Cannabis tanto en marihuana medicinal como en cáñamo. Un mayor conocimiento de esta planta llevará a producir mejor medicina, aceite y fibras para ropa, por ejemplo, y un sinnúmero de utilidades en diferentes campos.

En el artículo, nosotros los científicos de CGRI, investigamos el meollo de los organelos que operan gracias al sol, los cloroplastos. Nosotros también investigamos los cloroplastos del lúpulo, la planta más cercana a Cannabis y con el cual se produce la cerveza. Al usar los datos disponibles al público sobre el lúpulo, y con datos nuestros sobre el cáñamo, utilizamos computadores rápidos y poderosos para “leer” el ADN de los cloroplastos – su manual de instrucciones. Publicamos el genoma completo del cloroplasto para dos variedades del cáñamo y una del lúpulo. ¿Qué aprendimos? Primero, encontramos que el genoma del cloroplasto de las dos variedades del cáñamo son casi idénticas. Segundo, encontramos que el cloroplasto del cáñamo y del lúpulo difieren en un 1.1%. Esta semejanza tiene sentido ya que sabemos que el Cannabis y el lúpulo son las plantas más cercanas entre ellas y comparten un ancestro común como lo hacemos los humanos con los chimpancés, y el león con el jaguar. Este ancestro dio origen a estos dos géneros hace aproximadamente 30 millones de años. En otras palabras, nuestra investigación confirma lo que muchos rumberos han sospechado: la marihuana y la cerveza van de la mano.

Esta información es bastante importante, ya que nuestro artículo es un avance no solamente en Cannabis, sino en la evolución de todos los organismos vivos. Este artículo es una pequeña frase en una gran historia que nos demuestra que todos los organismos estamos relacionados unos a otros. Si viajamos a través del tiempo, incluso los humanos estamos relacionados con el cáñamo, compartimos un ancestro que vivió hace aproximadamente 1.6 billones de años.

Ciencia para nerdos

Esta nueva publicación muestra los genomas ensamblados (armados, reconstruidos) y anotados (fueron determinados el tamaño y la posición de cada gen) de dos plantas de Cannabis, dos variedades de cáñamo (Carmagnola y Dagestani), y de una planta de lúpulo (Humulus lupulus var. Saaze). Los datos genómicos para el lúpulo fueron descargados del repositorio NCBI. Estos datos hacen parte del ensamble genómico para esta planta. Para obtener los genomas de las dos variedades de Cannabis, Centennial Seeds, una compañía de semillas de Colorado se ofreció para hacer las extracciones de ADN. Nosotros les enseñamos a realizar las extracciones como se demuestra en este video grabado en las instalaciones de Centennial Seeds. Una vez extraído el ADN fue llevado al laboratorio del Profesor Kane para su posterior secuenciación.

¿Qué es un cloroplasto?

El cloroplasto es un organelo (órgano pequeño) que se encuentra dentro de la célula de las plantas y es responsable de llevar a cabo la fotosíntesis, importantísima función en las plantas que genera energía (alimento) usando la luz. De modo similar a los paneles solares, los cloroplastos generan energía, en este caso en la forma de azúcar, a partir del sol. ¡Muy ingeniosas las plantas! El cloroplasto tiene un genoma propio y pequeño, y la mayoría de los genes de este genoma están asociados a funciones relacionadas al proceso fotosintético.

¿Porqué tiene el cloroplasto un genoma?

Este es uno de los hallazgos maravillosos en biología, cómo una célula grande engulló a una célula pequeña (probablemente una cianobacteria) que era capaz de convertir en energía la luz, es decir fotosintetizaba. Este proceso llamado la teoría endosimbiótica explica como el cloroplasto en las plantas, y la mitocondria en la mayoría de los organismos eucariotes (organismos que tienen un núcleo) tienen ADN: alguna vez ellos fueron células vivas que, al ser engullidas, perdieron la mayoría de sus funciones proveídas por la célula grande pero conservaron su pequeño genoma.

Cosas super nerdas que estudiamos: el genoma de los cloroplastos

Generalmente, la mayoría de los genomas del cloroplasto (y de la mitocondria) son circulares como se ve en la Figura 1. En nuestra publicación describimos que los genomas cloroplásticos de Cannabis tienen 153,871 pares de bases* (bp en otras palabras letras del código de ADN). El cloroplasto del lúpulo tiene 153,751 bp, un poquito más pequeño que los de Cannabis. En general, los cloroplastos tienen cuatro regiones: el fragmento pequeño de copia única (SSC – por sus siglas en inglés), el fragmento largo de copia única (LSC) y dos repeticiones invertidas (IR). Tanto el SSC como el LSC están presentes una vez en el genoma, mientras que las IR están presentes dos veces: una vez con una orientación (5 prima a 3 prima -5’ a 3’) y la segunda vez en la orientación opuesta (3’ a 5’). Por convención, ya que el genoma del cloroplasto es circular, se lee en el sentido contrario de las manecillas del reloj, empieza con el LSC, seguido por la IR(A) que separa al LSC del SSC y luego la IR(B) se encuentra el final terminando el circulo (Figura 1).

C7_OGdraw_09092015

Figura 1. Representación gráfica del genoma del cloroplasto de la variedad de cáñamo Carmagnola. Cada uno de los cuadrados de colores representa un gen, y el tamaño de cada cuadrado representa el tamaño de cada gen- algunos genes tienen más nucleótidos que otros. El círculo interno de línea negra con marcas radiales también negras muestra las diferentes regiones del cloroplasto: el LSC es el fragmento más largo seguido por las dos IR y finalmente el fragmento más corto es el SSC.

Los dos cloroplastos de C. sativa son muy similares entre sí, son ricos en AT (63%) adenina y timina, lo que significa que contienen, en un 63% estos dos nucleótidos. Estos dos cloroplastos difieren en 16 SNPs (single nucleotide polymorphisms), o, en otras palabras, difieren en 16 nucleótidos. El LSC de ambos genomas de C. sativa tiene una longitud de 84,044 bp, las dos IR tienen una longitud de 26,007 bp, y el SSC es de 17,813 bp. Por otro lado, el genoma de lúpulo difiere de los dos de cáñamo en 1722 SNP (aproximadamente 1.1%), pero también es rico en AT. Cada una de las dos IR del cloroplasto del lúpulo tienen una longitud de 25,953 bp, separadas por el LSC de 84,109bp y el SSC de 17,736bp. Cada uno de los tres genomas contiene 83 genes.

¿Porqué es esto importante?

El análisis de estos datos es importante para el avance científico no solamente en Cannabis sino también, por ejemplo, para entender cómo evolucionan los genomas y cómo ciertos genes específicos cambian a través del tiempo. Además, los cloroplastos se heredan de la madre ya que están dentro de su óvulo mientras que los machos en los espermatozoides generalmente no tienen estos organelos. Por lo tanto, el genoma del cloroplasto nos indica sobre el linaje maternal del organismo, mientras que los genes del cromosoma Y (tanto en Cannabis como en humanos) son heredados del padre. Por lo tanto, cuando comparamos los genes provenientes de la madre (en la mitocondria o el cloroplasto) con los heredados del padre (en el cromosoma Y) podemos obtener historias diferentes (o similares) sobre los mecanismos de dispersión del polen y las semillas, o de dónde provienen los machos y las hembras.

Este trabajo también muestra que los dos cloroplastos de Cannabis son muy similares entre sí ya que difieren en sólo 16 de los 153,871 nucleótidos, y puede que hayan cambiado poco a través del tiempo. Podemos intuir esto porque las dos variedades de cáñamo tienen un cloroplasto casi idéntico en su código de ADN. Podríamos asumir, entonces, que el cáñamo cultivado por Jorge Cervantes, George Washington y el Neandertal Grok eran idénticos en su genoma cloroplástico? El CGRI esta llevando a cabo investigaciones para poder responder esta y muchas preguntas más!

Por favor apoye nuestra investigación a través de nuestra fundación sin ánimo de lucro The agricultural genomics foundation. Gracias a su apoyo financiero podremos realizar estudios que nos ayudarán a entender al Cannabis.

Figure 2. Blast (basic local alignment search tool) is an algorithm that compares DNA sequence data. This is the blast result of the carmagnola hemp chloroplast against itself, thus both the X and Y axes are the same. We can see a one to one line with a positive slope that represents the LSC and SSC. The lines with the negative slope represents the inverted repeats IR-A and IR-B. The little speckles in the graph represent small repetitive sequences.

Figure 2. Blast (basic local alignment search tool) is an algorithm that compares DNA sequence data. This is the blast result of the carmagnola hemp chloroplast against itself, thus both the X and Y axes are the same. We can see a one to one line with a positive slope that represents the LSC and SSC. The lines with the negative slope represents the inverted repeats IR-A and IR-B. The little speckles in the graph represent small repetitive sequences.

*Los eslabones que conforman la cadena de ADN son bases nitrogenadas llamados también nucleótidos que se presentan en pares, -pares de bases- , y estas bases son guanina, citosina, timina y adenina simbolizadas en la literatura por la inicial del nombre. Los pares se producen entre adenia y timina, y citosina y guanina; así un segmento de ADN se simboliza por CTTCTTTCCATCAACAAATGATGCTCA, y estas son emparejadas con su nucleótido complementario.

Haga click aquí para la versión en inglés

Anuncios

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s